Appendix XI V. Deoxyribonucleic Acid (DNA) Based Identification Techniques for Herbal Drugs

(No Ph. Eur. Method)

1. INTRODUCTION

Deoxyribonucleic Acid (DNA) barcoding has been widely used as a molecular method for the identification of herbal drugs. This method uses short regions of DNA with species specific sequences as barcodes for recognition. Within the British Pharmacopoeia, selected barcode sequences will be the basis for any molecular identification technique. Where a DNA-based method is specified within a monograph as an identification method, the identified region and its species specific sequence will be published as part of the monograph. An example of a barcoding protocol is given below and contains the methodology and the sequence of the region identified as specific to Ocimum tenuiflorum.

DNA barcoding of plant material is achieved by a multistage procedure involving DNA extraction, polymerase chain reactions (PCRs) and Sanger sequencing. DNA-based identification techniques for herbal drugs utilise PCR in the following two applications:

(a) to sequence a target region of DNA that contains key characters for species identification,

(b) the use of a species specific PCR for a target DNA sequence and subsequent detection of the amplicon.

The principles and quality requirements for these two applications are described. Alternate methods may be used if they comply with the quality requirements described below.

2. SCOPE OF METHOD

To establish the requirements for DNA extraction from herbal drug material and the use of this extracted DNA for either:

(a) amplification and sequencing of a target region of the extracted DNA for the purposes of species identification; or,

(b) amplicon production and detection techniques to demonstrate the presence of a defined DNA sequence as indicated in (a) and (b) under INTRODUCTION.

3. PRINCIPLE OF THE METHOD

DNA sequences for the identification of herbal drugs can be detected by either direct DNA sequencing or species specific amplification. Both techniques rely on the complementary base pairing of DNA. PCR must be utilised to amplify the target region.

Key stages of PCR are:

— double stranded DNA is denatured at high temperature to form single stranded DNA;
— two primers bind specifically to regions flanking the sequence to be amplified, one on either strand of DNA;
— a thermo-stable polymerase enzyme constructs the complementary DNA sequence starting from the primer binding positions;
— the three processes described above are repeated as required by the protocol, (typically between 30 and 40 times) to result in the formation of millions of copies of the sequence between the primer binding positions; this is the amplicon;
— the amplicon is detected by various means and can be used as the template for Sanger sequencing.

Key stages of Sanger sequencing are:

— the amplicons are denatured at high temperature to form single stranded DNA amplicons;
— one primer is used (this may be one used in the original PCR) and binds specifically to one end of the single stranded amplicons;
— a thermo-stable polymerase enzyme constructs the complementary DNA sequence, starting from the primer binding position;
— at random positions the construction of the complementary DNA sequence is halted due to the incorporation of a fluorescently labelled di-deoxynucleotide (ddNTP);
— amplicons are formed of every possible length, each with a fluorescently labelled ddNTP terminal end;
— amplicons are separated by capillary electrophoresis according to their length, and the fluorescent label recorded using a laser;
— the nucleotide identity at each base position of the amplicon is ascertained;
— this process is repeated with another primer (this may be one used in the original PCR) that binds specifically to the opposite end of the single stranded amplicons.

4. LABORATORY SET-UP REQUIREMENTS

Because of the high risk of contamination of the working materials with environmental, user or different sample DNA, segregation of working areas by time and/or space is an effective method of reducing this risk. The movement of people and materials between working areas should be kept to a minimum and be monitored. All areas should be suitably decontaminated before and after each use and safeguards introduced to prevent cross contamination of samples.

Recommended working areas include:

DNA extraction for the use of reagents and equipment used to extract DNA from plant materials;
Pre-PCR exclusively for the use of reagents, equipment and materials that have not encountered amplicons;
PCR equipment positioned in a dedicated area for the amplification process which occurs in a closed system;
post-PCR dedicated to amplicon detection methods, as for instance gel electrophoresis and UV transillumination.

5. DNA EXTRACTION

Pure DNA must be isolated from the herbal drug to be tested. Several methods are available for this purpose, including those based on commercial kits. Representative samples must be taken from each batch to be tested to ensure consistency, Appendix XI T. Herbal Drugs: Sampling and Sample Preparations. DNA extraction using 200 mg of herbal drug as a superfine powder is suitable for the test. DNA extraction should also be performed on herbal drug mixed with trnH-psbA BP Nucleic Acid Reference Material (BPNARM). The efficiency of the extraction shall be confirmed by PCR amplification of the trnH-psbA BPNARM and herbal drug DNA.

Many constituents present in herbal drugs are inhibitory to enzyme driven reactions such as PCR. Care must be taken to ensure that DNA used for testing is pure and sufficiently free from inhibitors. Inhibitors extracted with DNA can be removed by the use of purification procedures, an example is given under: DNA-BASED IDENTIFICATION OF OCIMUM TENUIFLORUM LINN (Holy Basil); 2. DNA PURIFICATION.

6. AMPLIFICATION

PCR amplification is conducted using defined cycling parameters, including denaturation and binding temperatures. Many different commercial enzymes and kits are available which can be used once validated for the intended purpose. When commercial kits are used the manufacturers’ guidelines for optimisation should be followed.

The concentrations shown below may be used as a generic starting point for method optimisation: Polymerase buffer (1x), MgCl2 (2.5 mM), DNA polymerase (1 Unit), Primers (0.1µM each), dNTPs (0.1µM each), DNA (10 ng may be suitable) and water MB.

To conduct a PCR the number of reactions required must be known. From each DNA extraction, 2 PCRs are required together with a positive and a negative control reaction. All common components should be measured and combined together to create a master mix, usually this will contain all solutions except the DNA. The master mix is divided equally between each reaction tube and the DNA is added individually.

All PCR tests should include relevant positive and negative controls. To the positive control reaction validated DNA should be added. A solution of trnH-psbA BPNARM is recommended. To the negative control, water MB should be added in place of the DNA.

7. DETECTION

Specific amplicons may be detected based on their size or composition.

Detection by size can be achieved by agarose gel electrophoresis or capillary electrophoresis.

Detection by sequence can be achieved by probe hybridisation or enzyme cleavage. Amplicon size and sequence both contribute to melt-curve analyses.

A valid test is only achieved if the positive control reaction(s) gives an unambiguously positive result and the negative control reaction gives an unambiguously negative result. A positive result can be shown by the presence of a band of the expected size using agarose gel electrophoresis. A negative result will be the absence of a band.

8. SEQUENCING

Sanger sequencing can be conducted using various commercially available kits and/or service providers. Any validated protocol may be followed and manufacturer’s guidelines may be used with commercial kits. A minimum of two reads must be produced for each DNA amplification, with at least one in either direction, and assembled into a contig. The contig should have an overall Phred score of at least 20; a value of 30 and over is preferable.

The text below is provided for information and describes the application of DNA-Based Identification techniques to a herbal drug.

DNA-BASED IDENTIFICATION OF Ocimum tenuiflorum Linn. (Holy Basil)

1. DNA EXTRACTION

Follow the procedure described in Appendix XI V, 5. DNA EXTRACTION.

2. DNA PURIFICATION

Care should be taken to ensure that inhibitory substances commonly found in Ocimum tenuiflorum herbal drug are removed from DNA subsequent to extraction. Many methods are available for this, as for instance the method using propan-2-ol MB described below:

— to 50 µL of DNA extraction solution add 35 µL of propan-2-ol MB at 4°, mix by pipetting;
— centrifuge at 14,000 revolutions per minute for 30 minutes at 4°;
— remove the supernatant, taking care not to disturb the pellet which may not be visible;
— re-suspend the pellet in 200 µL of ethanol (70%) at ambient temperature;
— centrifuge at 14,000 revolutions per minute for 10 minutes at ambient temperature;
— remove the supernatant liquid taking care not to disturb the pellet, allow any excess ethanol to evaporate at ambient temperature for at least 25 minutes or until dry.
— dissolve the pellet in 50 µL of tris-EDTA buffer pH 8.0;
— dilute 1 volume of the DNA solution with 9 volumes of tris-EDTA buffer pH 8.0 immediately prior to testing.

3. Amplification

Prepare as described in Appendix XI V, 6. AMPLIFICATION.

Amplification of the trnH-psbA region of the plastid genome is achieved using the following primers and cycling programme.

Primer name
Sequence (5ʹ to 3ʹ)
trnH
CGCGCATGGTGGATTCACAATCC
psbA
GTTATGCATGAACGTAATGCTC

Cycling programme:

— initial denaturation step of 5 minutes at 95°;
— 35 cycles consisting of:
— 1 minute at 95°;
— 30s at touchdown temperature;
— 1 minute at 72°;
— final extension period of 7 minutes at 72°;

The touchdown temperature begins at 58° and is reduced by 1° per cycle until 48°, then continued at 48° for the remainder of the program.

If amplification is unsuccessful after purification and dilution of the DNA sample, secondary PCR using 1 µL of the initial amplification as the template for a second is acceptable using the same parameters.

4. Amplicon Detection

Any validated method may be used for this purpose; agarose gel electrophoresis incorporating a DNA specific dye is suitable. Recommended parameters are a 1.0% w/v gel made with 0.5x TBE buffer MB, run at 60V for 1 hour and subsequently visualised in an appropriate system such as a UV transilluminator.

A positive result is shown by the presence of a band of the expected size (approximately 400 bp); a DNA ladder should be run adjacent to the samples to show size separation. A negative result is shown by the absence of a band at this position on the gel.

5. Sequencing

The amplicon is sequenced using the amplification primers and is conducted as described under Appendix XI V, 8. SEQUENCING

6. Ocimum tenuiflorum trnH-psbA region sequence

The sequence of the trnH-psbA spacer region for Ocimum tenuiflorum is given below, with the bases shown in lower case text being the key bases for identification. These must be checked against all contigs produced using multiple alignment software (Clustal Omega may be suitable).

7. Sequence matching

trnH-psbA sequences for the identification of Ocimum tenuiflorum samples must be a minimum of 300 bp in length, and must cover the key bases for identification. Overall matching of the sequences should be above 95%, and the key bases must match 100% with no gaps.

GLOSSARY

This glossary of terms relating to Appendix XI V is published for information only

Table XI V-1

Term
Definition
Amplicon
The DNA product of a PCR.
Amplification
The copying of DNA during a PCR.
Base call
The identification of a DNA base by sequencing software.
Base pair (bp)
The complementary pairing of two nucleotides, A&T or G&C, which forms the unit of measurement for the length of a DNA molecule.
BPNARM
British Pharmacopoeia Nucleic Acid Reference Material.
Consensus sequence
The product of the combining of several individual DNA sequencing reads, providing a consensus of the correct sequence.
Contig
A set of overlapping DNA sequencing reads from one sample which can be used to produce a consensus sequence.
Deoxynucleotide (dNTP)
The monomer or individual unit of DNA; Adenine (A), Cytosine (C), Guanine (G) and Thymine (T).
di-deoxynucleotide (ddNTP)
A modified form of the DNA monomer without an -OH group present on the 3ʹ carbon of the deoxyribose sugar which is required to bind a subsequent nucleotide.
Deoxyribonucleic Acid, a double stranded, helical molecule.
DNA ladder
Mixture of DNA molecules of known base pair length. These provide a measure of how far a DNA molecule travels during gel electrophoresis.
Master mix
A mixture containing the common components for several PCRs, this is made in a large batch or master mix which is then divided between individual reactions. Master mixes contain enough reagents for the required number of tests, typically plus one to allow for pipetting errors.
Mix by pipetting
Drawing up and expelling a substance up to ten times using an automatic pipette, with the aim of mixing the solutions.
Water MB
Deionised, filtered and autoclaved water.
Negative control
A reaction which comprises all but one essential component, thereby proving the necessity of the absent substance.
PCR
Polymerase Chain Reaction - an enzyme driven reaction where DNA molecules are replicated.
Phred score
The likelihood that a base call in a DNA sequence is incorrect, a score of 20 has a 1 in 100 probability of being an incorrect call, 30 is 1 in 1000 etc.
Positive control
A reaction comprising all common PCR components and a known DNA sample, thereby proving the suitability of all reagents.
Primer (oligonucleotide)
A short single stranded DNA molecule which binds to the DNA to be amplified in a PCR. This enables the enzyme to commence replication, and therefore the binding positions define the start and finish point of the PCR.
Probe hybridisation
The complementary binding of an oligonucleotide to a target DNA molecule causing a measurable response.
Sanger sequencing
The method by which a DNA sequence is resolved, developed by Frederick Sanger and colleagues.
Sequencing
Identifying the order of the nucleotide sequence of DNA.
Thermal cycler
The machine that performs the cycling of temperatures required for a PCR.